NG214-TIANSeq Single-Index Adapter -201012
TIANSeq Single-Index Adapter (Illumina)
Cat.no. 4992641/4992642/4992378

Storage and Working Conditions
Upon receiving the kit, please store at -30~-15°C. The shelf life of the kit is
one year.
TIANSeq Single – Indexed Adapter should not be kept at more than 25°C.
Avoid repeated freezing and thawing. Please store at -30~-15°Cafter use.
Adapter Dilution Buffer can be stored at 2-8°Cfor a month. For long-term
storage, please keep at -30~-15°C.
Product Description
TIANSeq Single-Indexed Adapter is specifically developed for illumina Highthroughput sequencing platform. It can be used to construct DNA and RNA
libraries for illumina High-throughput sequencing platform. The kit is provided
in two forms: 12 kinds of adapters mix and 24 kinds of adapters mix, and each
adapter in the mix contains a unique 6 base index sequence (barcode) to identify
different samples in multi-sample sequencing.
The concentration of the adapter mastermix of this kit is 30 µM. The working
concentration varies with the kit used for the library construction, the initial DNA
input and the size of DNA fragments. Please refer to the protocol for specific
information. In addition, the Index sequences of the 24 adapters mix are shown in
the Adapter Sequence Information section.
Applications:
- Generally, this product is used for the construction of DNA and RNA libraries
for NGS of illumina High-throughput sequencing platform. - Specific applications of this product include exon sequencing, target region
sequencing, RNA-Seq, ChIP-Seq, directed sequencing and whole genome
sequencing. - It should be noted that this product is not suitable for Illumina HiSeq X
TM instruments and methylation-related sequencing.
Precautions Please carefully read these precautions before using this
kit
- It is recommended to keep the TIANSeq Single – Indexed Adapter on ice or in an
ice box during the experiment. Please do not place the product at more than
25°C, otherwise the advanced structure of adapter might be damaged. - If adapter needs to be diluted, please use the Adapter Dilution Buffer supplied
in the kit. Don’t use ultrapure water or other buffer. - The diluted adapter should be prepared and used within one day. It is not
recommended to store the diluted adapter for a long time, or repeatedly freeze
and thaw the diluted adapter. - Please use nuclease- and nucleic acid-free consumables. Make sure to use the
consumables made by low nucleic acids adsorption materials. In addition, crosscontamination between adapters should be avoided during the experiment.
Recommended Alternative Reagents:
- TIANSeq DirectFast DNA Library Prep Kit (illumina)
- TIANSeq Fast DNA Library Prep Kit (illumina)
Protocol
1.If the volume of TIANSeq single-indexed Adapter added in the ligation system
is fixed at 5 µl, then the working concentrations of the adapter for different DNA
input and DNA fragment sizes are shown in the following table:

- When the TIANGEN library construction products are applied TIANSeq
DirectFast DNA Library Prep Kit (illumina) and TIANSeq Fast DNA Library Prep
Kit (illumina) , please dilute the adapter master mix according to the DNA input
range of the relevant products using the above table as reference. - When applying the library construction products from other suppliers, if the
DNA input is greater than 1 µg, dilute the adapter based on the standard of
10:1 mole ratio between the adapter and the inserted fragment; if the DNA
input is less than 0.25 ng, dilute adapter based on the standard of 200:1 molar
ratio between the adapter and the inserted fragment. The mole number of DNA
input is calculated according to the following formula:

- For the DNA fragments with sizes not shown in the table, the mole number of
DNA input can also be calculated according to the above formula.
Adapter Sequence Information
The sequence information of the adapters in this kit is listed below:
- Universal Sequence
5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGA
TCT-3’ - Index Including Sequence
5′-GATCGGAAGAGCACACGTCTGAACTCCAGTCAC [ index1-27] ATCTCGTATGCCGTCTTCTGCTTG-3′ - Index Number and Sequences

Ingredients of the Adapter Dilution Buffer
10 mM Tris-HCl, 10 mM NaCl, 1 mM EDTA, pH 8.0~8.5 @ 25°C.
NG214-TIANSeq Single-Index Adapter -201012
All trademarks or registered trademarks appearing on this website are the property of their respective owners.
This product is for scientific research use only. Do not use in medicine, clinical treatment, food or cosmetics.
Need more info ? Contact us anytime. We’re here: Go2biotech
E-mail: maggie@go2biotech.com / morgan@go2biotech.com
Telephone:+86 755 8399 5017
