Talent qPCR PreMix (SYBR Green)-GFP209

.. 83 / Publication

Good resistance to impurity interference and rapid quantification of complex templates

Catalog number / packaging

 Manual Inquire

• StorageStore at -20℃.
• DescriptionThis product is a special reagent for Real-Time PCR using SYBR Green I chimeric fluorescence. The 2×Talent qPCR PreMix adopts antibody-modified Anti Taq DNA polymerase, and the unique qPCR Buffer system can ensure the product to carry out highly sensitive and fast qPCR reaction on all Real-Time PCR instruments. The qPCR reaction time can be shortened by 50%. In addition, the addition of H-Competitor factor and EP component in Buffer makes the product have a wide range of sample universality. It has very good applicability to templates with complex advanced structures, templates with more PCR inhibitor residues, long fragment amplification, etc.The product also has the characteristics of high amplification rate, high amplification specificity, wide credible range, etc., and can obtain results faster without affecting the PCR effect.
• Features■ Highly sensitive antibody modified polymerase can shorten the reaction time by half.■ The H-Competitor competes with hydrogen bond, which ensures higher amplification efficiency of templates with high GC content, complex secondary structure and long templates.■ EP component stabilizes PCR system, effectively protects enzyme activity and resists interference of various inhibitors.■ Colorless transparent tube replaces brown tube, so that the remaining amount is visible.
• ApplicationsIt is suitable for expression analysis, nucleic acid detection and other types of experiments on various real time PCR instruments by SYBR Green method, especially for high GC, complex secondary structure, high impurity residue and long template quantification.

Publication

.. 83 / Publication

Sort by

Impact Factor

Journals

–

• Effects of soybean oil exposure on the survival, reproduction, biochemical responses, and gut microbiome of the earthworm Eisenia fetida.Journal of environmental sciences (China)2023-07-17 Read ArticleAbstract: With increasing production of kitchen waste; cooking oil gradually enters the soil; where it can negatively affect soil fauna.. In this study; we explored the effects of soybean oil on the survival; growth; reproduction; tissue structure; biochemical responses; mRNA expression; and gut microbiome of earthworms ( Eisenia fetida ).. The median lethal concentration of soybean oil was found to be 15.59%.
• A newly identified small tRNA fragment reveals the regulation of different wool types and oxidative stress in lambsScientific Reports2023-06-23 Read Article.. ??L reverse primer: CGTACCCGGTCCTTTACTTG; 10 ??L qPCR PreMix (TIANGEN; FP209-01; China); 8 ??L ddH2O.
• A newly identified small tRNA fragment reveals the regulation of different wool types and oxidative stress in lambsScientific Reports2023-06-23 Read Articleof total tRNA. The entire Q-PCR was performed in a 20????L system; containing 1????L total cDNA; 0.5????L forward primer: TACCCACCAAGTCACCATC; 0.5????L reverse primer: CGTACCCGGTCCTTTACTTG; 10????L qPCR PreMix (TIANGEN; FP209-01; China); 8????L ddH2O. The reaction was performed for 5??min at 95????C; followed by 30??s at 95????C; with a subsequent 40 cycles of amplification (95????C for 5??s; 60????C for 10??s and 72????C f
• Molecular-electromechanical system for unamplified detection of trace analytes in biofluidsNature Protocols2023-05-19 Read Articlereagent (Thermo Fisher Scientific; cat. no. 15596026; store at RT) SuperScript III CellsDirect cDNA synthesis kit (Thermo Fisher Scientific; cat. no. 18080300; store at ???20 ??C) qRT??PCR detection kit (Tiangen; cat. no. FP209; store at ???20 ??C) RNase inhibitor (Applied Biosystems; cat. no. N8080119; store at ???20 ??C) SARS-CoV-2 IVT RNA; nt 13;321??15;540 (Shanghai Institute of Measurement and Testing T
• Oscillatory-Flow PCR Microfluidic Chip Driven by Low Speed Biaxial CentrifugationBiosensors2023-05-18 Read Articlerd: 5??-ATTTGAGCGGCTGGAAAGAG-3??; yhaI-reverse: 5??-AGCGGCCGATATCATGCAT-3??; PEX-2-forward: 5??-CGATCAGTCCCCAAGTGAAT-3??; PEX-2-reverse: 5??-AGTCTACCGGTGCAACCAAC-3??. The Talent Quantitative Assay Kit (FP209; Tiangen; Beijing; China) was used to prepare 20 ??L PCR reactions for all PCR tests. The reaction contained 7.8 ??L Talent qPCR PreMix (SYBR GREEN); 10 ??L RNase-Free ddH 2 O; 0.6 ??L forward primer; 0.6

Talent qPCR PreMix (SYBR Green)

Need more info ? Contact us anytime. We’re here:
Go2biotech
E-mail: maggie@go2biotech.com / morgan@go2biotech.com
Telephone:+86 755 8399 5017
Address: Rm 4L, Golden Century Building, Shennan Av. 6033#, Shenzhen, China